Skip to main content

TRS6E1b-luc(-732/-721) mutant 3
(Plasmid #45386)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45386 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL2 Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5700
  • Modifications to backbone
    E1bTATA inserted upstream of luciferase
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    6 copies of hPAI-1 promoter -732/-721 mutated at -723/-721
  • Alt name
    TRS6 m3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    72
  • Mutation
    -723/-721 mutated from tgt to aca
  • Tag / Fusion Protein
    • luciferase

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (not destroyed)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer TGTATCTTATGGTACTGTAACT from Promega
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA from Promega
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRS6E1b-luc(-732/-721) mutant 3 was a gift from Thomas Gelehrter (Addgene plasmid # 45386 ; http://n2t.net/addgene:45386 ; RRID:Addgene_45386)
  • For your References section:

    Smad4/DPC4 and Smad3 mediate transforming growth factor-beta (TGF-beta) signaling through direct binding to a novel TGF-beta-responsive element in the human plasminogen activator inhibitor-1 promoter. Song CZ, Siok TE, Gelehrter TD. J Biol Chem. 1998 Nov 6;273(45):29287-90. 10.1074/jbc.273.45.29287 PubMed 9792626