pflaG
(Plasmid
#45477)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45477 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJB98
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameflaA-GFP
-
Alt nameMB354
- Promoter flaA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site PstI (unknown if destroyed)
- 5′ sequencing primer aaggatcctttgcgacttttcaaaaaagc
- 3′ sequencing primer GFPfusionREV (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pflaG was generated by subcloning the 0.8kb XbaI/PstI fragment encoding GFP and T7 gene 10 rbs from pGFPmut3 into pJB98. The flaA promoter including its -35, -10, and transcriptional start sites were amplified from the chromosomal DNA of L. pneumophila 02 and ligated directly upstream of GFP using BamHI/XbaI.
pJB98 was generated from pKB5 (Berger and Isberg, 1993) by deletion of ~1.5kb HpaI/EcoRI fragment containing the ptac promoter and lacIq gene.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pflaG was a gift from Michele Swanson (Addgene plasmid # 45477 ; http://n2t.net/addgene:45477 ; RRID:Addgene_45477) -
For your References section:
Co-ordination of legionella pneumophila virulence with entry into stationary phase by ppGpp. Hammer BK, Swanson MS. Mol Microbiol. 1999 Aug;33(4):721-31. 10.1046/j.1365-2958.1999.01519.x PubMed 10447882