pflaG
(Plasmid #45477)

• Depositing Lab: Michele Swanson
• Publication: Hammer et al Mol Microbiol. 1999 Aug;33(4):721-31.

Backbone

• Vector backbone: pJB98
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: flaA-GFP
• Alt name: MB354
• Promoter: flaA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: PstI (unknown if destroyed)
• 5′ sequencing primer: aaggatcctttgcgacttttcaaaaaagc
• 3′ sequencing primer: GFPfusionREV

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pflaG was generated by subcloning the 0.8kb XbaI/PstI fragment encoding GFP and T7 gene 10 rbs from pGFPmut3 into pJB98. The flaA promoter including its -35, -10, and transcriptional start sites were amplified from the chromosomal DNA of L. pneumophila 02 and ligated directly upstream of GFP using BamHI/XbaI.

pJB98 was generated from pKB5 (Berger and Isberg, 1993) by deletion of ~1.5kb HpaI/EcoRI fragment containing the ptac promoter and lacIq gene.