Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

BB-­NIC-­II-­HisN-­TET12
(Plasmid #45496)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45496 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    BB-NIC-II-HisN
  • Backbone size w/o insert (bp) 2288
  • Total vector size (bp) 3629
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TET12
  • Species
    Synthetic
  • Insert Size (bp)
    1386
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHistidine tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NgoMIV (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer cattaacctataaaaataggcgtatcacg
  • 3′ sequencing primer CTTTGAGTGAGCTGATACCGCTCGCC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BB-­NIC-­II-­HisN-­TET12 was a gift from Roman Jerala (Addgene plasmid # 45496 ; http://n2t.net/addgene:45496 ; RRID:Addgene_45496)
  • For your References section:

    Design of a single-chain polypeptide tetrahedron assembled from coiled-coil segments. Gradisar H, Bozic S, Doles T, Vengust D, Hafner-Bratkovic I, Mertelj A, Webb B, Sali A, Klavzar S, Jerala R. Nat Chem Biol. 2013 Apr 28. doi: 10.1038/nchembio.1248. 10.1038/nchembio.1248 PubMed 23624438