Skip to main content
Addgene

pCELF PAI-RBP v3
(Plasmid #45507)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45507 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCEFL
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PAI-RBP v3
  • Alt name
    plasminogen activator inhibitor type 1 variant 3
  • Species
    H. sapiens (human), R. norvegicus (rat)
  • Insert Size (bp)
    1200
  • Entrez Gene
    SERBP1 (a.k.a. CGI-55, CHD3IP, HABP4L, PAI-RBP1, PAIRBP1)
  • Tag / Fusion Protein
    • GST tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer TTCTTCCATTTCAGGTGTCG information from Addgene
  • 3′ sequencing primer SP6 information from Addgene
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Resource Center and Primary Database of the German Human Genome Project

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Our lab isolated the protein based on it's ability to bind to a region of the PAI-1 (plasminogen activator inhibitor type 1) 3'UTR that we had determined to be involved in the cAMP regulation of mRNA stability. A search of the database revealed that the cDNA for the protein had been cloned by the German Genome Project and dubbed hypothetical protein. They kindly provided us with the clone, which we subcloned into pET-15b for expression of the protein and then into CMV-Flag for mammalian expression.
Subsequently, we discovered isoforms of the protein with or without 6 and/or 15 amino acid insertions. Variant 3 lacks the 6 amino acid insertion but includes the 15 amino acid insertion.
Additional reference: Heaton, JH et al 2003 Thromb Haemost 89; 959-966.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCELF PAI-RBP v3 was a gift from Thomas Gelehrter (Addgene plasmid # 45507 ; http://n2t.net/addgene:45507 ; RRID:Addgene_45507)
  • For your References section:

    Identification and cDNA cloning of a novel RNA-binding protein that interacts with the cyclic nucleotide-responsive sequence in the Type-1 plasminogen activator inhibitor mRNA. Heaton JH, Dlakic WM, Dlakic M, Gelehrter TD. J Biol Chem. 2001 Feb 2;276(5):3341-7. Epub 2000 Sep 22. 10.1074/jbc.M006538200 PubMed 11001948