Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRII-Topo Crym in situ probe
(Plasmid #45601)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45601 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCRII-Topo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4400
  • Vector type
    in situ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Crym in situ probe
  • Alt name
    mu-crystallin
  • Alt name
    crystallin, mu
  • Alt name
    Crym
  • Species
    M. musculus (mouse)
  • Mutation
    fragment contains nt 756-1191 of NM_016669
  • GenBank ID
    NM_016669
  • Entrez Gene
    Crym

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Fragment was amplified using the following primers:
ACTGGCGAGAACTGGATGAC
GCCATCACCCCTTAACAGAA
For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-Topo Crym in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45601 ; http://n2t.net/addgene:45601 ; RRID:Addgene_45601)
  • For your References section:

    Neuronal subtype-specific genes that control corticospinal motor neuron development in vivo. Arlotta P, Molyneaux BJ, Chen J, Inoue J, Kominami R, Macklis JD. Neuron. 2005 Jan 20;45(2):207-21. 10.1016/j.neuron.2004.12.036 PubMed 15664173