Skip to main content

pCRII-Topo Tcrb-V13 in situ probe
(Plasmid #45622)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45622 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRII-Topo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4500
  • Vector type
    in situ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tcrb-V13 in situ probe
  • Alt name
    T cell receptor beta chain
  • Alt name
    TcrB
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    527
  • Mutation
    fragment contains bp# 533-1058 of X67128
  • GenBank ID
  • Entrez Gene
    Tcrb (a.k.a. TCRbeta, Tib)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Tcrb-V13 fragment was amplified by RT-PCR using the following primer pair:
CTGAGCTGGTGGGTGAATG
AAGGTGTCAACGAGGAAGGA

For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 533-1058 of X67128, not bp# 532-1059 as indicated on plasmid map. The plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-Topo Tcrb-V13 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45622 ; http://n2t.net/addgene:45622 ; RRID:Addgene_45622)
  • For your References section:

    Fezl is required for the birth and specification of corticospinal motor neurons. Molyneaux BJ, Arlotta P, Hirata T, Hibi M, Macklis JD. Neuron. 2005 Sep 15;47(6):817-31. 10.1016/j.neuron.2005.08.030 PubMed 16157277