pCRII-Topo Cux2 in situ probe
(Plasmid
#45623)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45623 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCRII-Topo
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4600
-
Vector typein situ
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCux2 in situ probe
-
Alt nameCux2
-
Alt namecut-like homeobox 2
-
SpeciesM. musculus (mouse)
-
Mutationfragment contains nt 1069-1694 on NM_007804
-
Entrez GeneCux2 (a.k.a. 1700051K22Rik, Cutl2, Cux-2)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Rev, Sp6
- 3′ sequencing primer T7, M13 Forward (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Cux2 fragment was amplified by RT-PCR using the following primer pair:
TCAGTCAACAGCTCCATTCG
GACAGCGAGAAAGTCCTTGG
For in vitro transcription, use the HindIII restriction digest and T7 promoter for sense probe generation and the NotI restriction digest and SP6 promoter for antisense probe generation.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo Cux2 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45623 ; http://n2t.net/addgene:45623 ; RRID:Addgene_45623) -
For your References section:
Fezl is required for the birth and specification of corticospinal motor neurons. Molyneaux BJ, Arlotta P, Hirata T, Hibi M, Macklis JD. Neuron. 2005 Sep 15;47(6):817-31. 10.1016/j.neuron.2005.08.030 PubMed 16157277
Map uploaded by the depositor.