pCR2.1-SNORD116-3
(Plasmid
#45891)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCR2.1
-
Backbone manufacturerInvitrogene
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSNORD115 with 80nt from intron sequence but without flanking exons
-
Alt nameHBII-85
-
SpeciesH. sapiens (human)
-
Insert Size (bp)177
-
GenBank IDEntrez Gene: 100033415
-
Entrez GeneSNORD116-3 (a.k.a. HBII-85-3)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer GCCCTTTACCCGTGAACCAC
- 3′ sequencing primer GCCCTTCAGCCTATGATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCR2.1-SNORD116-3 was a gift from Stefan Stamm (Addgene plasmid # 45891 ; http://n2t.net/addgene:45891 ; RRID:Addgene_45891) -
For your References section:
Molecular characterization of a patient presumed to have prader-willi syndrome. Falaleeva M, Sulsona CR, Zielke HR, Currey KM, de la Grange P, Aslanzadeh V, Driscoll DJ, Stamm S. Clin Med Insights Case Rep. 2013 May 5;6:79-86. doi: 10.4137/CCRep.S11510. Print 2013. PubMed 23700380