Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCR2.1-SNORD116-3
(Plasmid #45891)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45891 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR2.1
  • Backbone manufacturer
    Invitrogene
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SNORD115 with 80nt from intron sequence but without flanking exons
  • Alt name
    HBII-85
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    177
  • GenBank ID
    Entrez Gene: 100033415
  • Entrez Gene
    SNORD116-3 (a.k.a. HBII-85-3)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer GCCCTTTACCCGTGAACCAC
  • 3′ sequencing primer GCCCTTCAGCCTATGATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCR2.1-SNORD116-3 was a gift from Stefan Stamm (Addgene plasmid # 45891 ; http://n2t.net/addgene:45891 ; RRID:Addgene_45891)
  • For your References section:

    Molecular characterization of a patient presumed to have prader-willi syndrome. Falaleeva M, Sulsona CR, Zielke HR, Currey KM, de la Grange P, Aslanzadeh V, Driscoll DJ, Stamm S. Clin Med Insights Case Rep. 2013 May 5;6:79-86. doi: 10.4137/CCRep.S11510. Print 2013. PubMed 23700380