Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pE-FLP
(Plasmid #45978)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45978 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, low (50ug/mL)
  • Growth Temperature
    30°C
  • Growth Strain(s)
    E811 (P2 lysogen)
  • Growth instructions
    For propagation, please grow this plasmid in the original strain (E811) In that strain, the strong promoter pE will be repressed, thus avoiding possible toxicity and accumulation of unwanted mutations in the plasmid. Use 50ug/ml ampicillin (100ug/ml may inhibit growth)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    flp
  • Alt name
    flippase
  • Insert Size (bp)
    1272
  • Mutation
    flp driven by the constitutive promoter pE from phage P2
  • Promoter pE (from phage P2)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGAATAAGGGCGACACGGAAATGTTGAATA
  • 3′ sequencing primer CCGTTACATATCAAAGGGAAAACTGTCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The flippase gene was amplified from pCP20 (e.g. available from the Coli Genetic Stock Center)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Can be used to remove the integration module (including the antibiotic resistance cassette) from pOSIP integrants.

Reference:
St-Pierre F, Cui L et al., "One-step cloning and chromosomal integration of DNA", ACS Synthetic Biology, http://pubs.acs.org/doi/abs/10.1021/sb400021j

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pE-FLP was a gift from Drew Endy & Keith Shearwin (Addgene plasmid # 45978 ; http://n2t.net/addgene:45978 ; RRID:Addgene_45978)
  • For your References section:

    One-step cloning and chromosomal integration of DNA. St-Pierre F, Cui L, Priest DG, Endy D, Dodd IB, Shearwin KE. ACS Synth Biol. 2013 Sep 20;2(9):537-41. doi: 10.1021/sb400021j. Epub 2013 May 20. 10.1021/sb400021j PubMed 24050148