Skip to main content

pattB-synaptobrevin-2-G4BDMD-QFAD-hsp70
(Plasmid #46110)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46110 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pattB
  • Backbone size w/o insert (bp) 7400
  • Total vector size (bp) 12360
  • Modifications to backbone
    Introduced synaptobrevin promoter
  • Vector type
    Insect Expression
  • Selectable markers
    white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    G4BDMD-QFAD
  • Alt name
    GAL4 binding domain
  • Alt name
    GAL4 middle domain
  • Alt name
    QF activation domain
  • Insert Size (bp)
    2775

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site AatII (not destroyed)
  • 5′ sequencing primer SYBFOR5: TGGAAGACAGTGAAAGAGGC
  • 3′ sequencing primer hsp70REV-SEQ:GCAAACTCACTCCCTGACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene's sequencing results found a deletion of bp# 9542-9556 when compared to the full plasmid sequence. The depositing laboratory states that this difference is not a concern for the function of the plasmid.

Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pattB-synaptobrevin-2-G4BDMD-QFAD-hsp70 was a gift from Christopher Potter (Addgene plasmid # 46110 ; http://n2t.net/addgene:46110 ; RRID:Addgene_46110)
  • For your References section:

    Improved and expanded Q-system reagents for genetic manipulations. Riabinina O, Luginbuhl D, Marr E, Liu S, Wu MN, Luo L, Potter CJ. Nat Methods. 2015 Jan 12. doi: 10.1038/nmeth.3250. 10.1038/nmeth.3250 PubMed 25581800