pattB-synaptobrevin-14-LEXA-QF-hsp70
(Plasmid
#46123)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46123 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepattB
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 10719
-
Modifications to backboneIntroduced synaptobrevin promoter
-
Vector typeInsect Expression
-
Selectable markerswhite
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLexA-QF
-
Alt nameLexA DNA binding domain
-
Alt nameQF Activation Domain
-
Alt nameLexA-QF#14
-
SpeciesSynthetic
-
Insert Size (bp)1113
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site AatII (not destroyed)
- 5′ sequencing primer SYBFOR5: TGGAAGACAGTGAAAGAGGC
- 3′ sequencing primer hsp70REV-SEQ:GCAAACTCACTCCCTGACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pattB-synaptobrevin-14-LEXA-QF-hsp70 was a gift from Christopher Potter (Addgene plasmid # 46123 ; http://n2t.net/addgene:46123 ; RRID:Addgene_46123) -
For your References section:
Improved and expanded Q-system reagents for genetic manipulations. Riabinina O, Luginbuhl D, Marr E, Liu S, Wu MN, Luo L, Potter CJ. Nat Methods. 2015 Jan 12. doi: 10.1038/nmeth.3250. 10.1038/nmeth.3250 PubMed 25581800