mcherry(C1)_RepoMan/RAXA
              
              
                (Plasmid
                
                #46275)
              
            
            
            
          - 
              Depositing Labs
 - 
          Sequence Information
 
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepmcherry-C1
 - 
              Backbone manufacturerClontech
 - Backbone size w/o insert (bp) 4700
 - Total vector size (bp) 7772
 - 
              Vector typeMammalian Expression
 - 
                Selectable markersNeomycin (select with G418)
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameRepoMan
 - 
                  Alt nameCDCA2
 - 
                    SpeciesH. sapiens (human)
 - 
                  Insert Size (bp)3072
 - 
                  MutationV393A/F395A
 - 
                    GenBank IDNM_152562
 - 
                        Entrez GeneCDCA2 (a.k.a. PPP1R81, Repo-Man)
 - 
    
        Tag
        / Fusion Protein
    
- mcherry (N terminal on backbone)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site Asp718 (unknown if destroyed)
 - 3′ cloning site BamH1 (unknown if destroyed)
 - 5′ sequencing primer CAACGTCAACATCAAGTTGG
 - 3′ sequencing primer GTTTGGACAAACCACAACTAGAATGCAG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
mcherry(C1)_RepoMan/RAXA was a gift from Angus Lamond & Laura Trinkle-Mulcahy (Addgene plasmid # 46275 ; http://n2t.net/addgene:46275 ; RRID:Addgene_46275) - 
                
For your References section:
Repo-Man recruits PP1 gamma to chromatin and is essential for cell viability. Trinkle-Mulcahy L, Andersen J, Lam YW, Moorhead G, Mann M, Lamond AI. J Cell Biol. 2006 Feb 27;172(5):679-92. Epub 2006 Feb 21. 10.1083/jcb.200508154 PubMed 16492807 
Map uploaded by the depositor.