Skip to main content
Addgene

pTK158_mCherry-4.1G-deltaCTD-hardened
(Plasmid #46360)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46360 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 7478
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    4.1G
  • Species
    H. sapiens (human)
  • Mutation
    Deleted amino acids 886-1005, and modified for siRNA resistance to gcTccTcaTttCgaAcgGacAAGC
  • Entrez Gene
    EPB41L2 (a.k.a. 4.1-G, 4.1G)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTK158_mCherry-4.1G-deltaCTD-hardened was a gift from Iain Cheeseman (Addgene plasmid # 46360 ; http://n2t.net/addgene:46360 ; RRID:Addgene_46360)
  • For your References section:

    Cortical dynein and asymmetric membrane elongation coordinately position the spindle in anaphase. Kiyomitsu T, Cheeseman IM. Cell. 2013 Jul 18;154(2):391-402. doi: 10.1016/j.cell.2013.06.010. 10.1016/j.cell.2013.06.010 PubMed 23870127