Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

AB.pCCL.sin.cPPT.U6.miR-17-Decoy.hPGK.GFP.WPRE
(Plasmid #46594)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46594 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AB.pCCLsin.PPT.U6.hPGK.GFP.wpre
  • Backbone size w/o insert (bp) 8233
  • Vector type
    Lentiviral
  • Selectable markers
    eGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    miR-17 Decoy
  • Alt name
    8260
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    83
  • Entrez Gene
    MIR17 (a.k.a. MIR17-5p, MIR91, MIRN17, MIRN91, hsa-mir-17, miR-17, miR17-3p, miRNA17, miRNA91)
  • Entrez Gene
    Mir17 (a.k.a. Mirn17, mir-17, mmu-mir-17)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer CATAATAGCAACAGACATAC
  • 3′ sequencing primer pBluescriptSK_primer
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AB.pCCL.sin.cPPT.U6.miR-17-Decoy.hPGK.GFP.WPRE was a gift from Brian Brown (Addgene plasmid # 46594 ; http://n2t.net/addgene:46594 ; RRID:Addgene_46594)
  • For your References section:

    High-throughput assessment of microRNA activity and function using microRNA sensor and decoy libraries. Mullokandov G, Baccarini A, Ruzo A, Jayaprakash AD, Tung N, Israelow B, Evans MJ, Sachidanandam R, Brown BD. Nat Methods. 2012 Jul 1;9(8):840-6. doi: 10.1038/nmeth.2078. 10.1038/nmeth.2078 PubMed 22751203