Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PCMV-intron myc Rab1a S25N
(Plasmid #46777)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46777 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV-intron myc
  • Modifications to backbone
    intron-myc inserted HindIII/XbaI. Intron enhances stability of mRNA.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rab1a S25N mutant
  • Alt name
    member RAS oncogene family
  • Alt name
    Rab1a
  • Species
    H. sapiens (human)
  • Mutation
    S25N (dominant negative)
  • Entrez Gene
    RAB1A (a.k.a. RAB1, YPT1)
  • Promoter CMV
  • Tag / Fusion Protein
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer BGH Reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

cDNA was obtained from UMR cDNA Resource Center, www.cdna.org

To make mutation, the following primers were used for PCR amplification:
Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′)
BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PCMV-intron myc Rab1a S25N was a gift from Terry Hébert (Addgene plasmid # 46777 ; http://n2t.net/addgene:46777 ; RRID:Addgene_46777)
  • For your References section:

    Seven transmembrane receptor core signaling complexes are assembled prior to plasma membrane trafficking. Dupre DJ, Robitaille M, Ethier N, Villeneuve LR, Mamarbachi AM, Hebert TE. J Biol Chem. 2006 Nov 10;281(45):34561-73. Epub 2006 Sep 7. 10.1074/jbc.M605012200 PubMed 16959776