-
Purposeexpression of S25N Rab1a in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV-intron myc
-
Modifications to backboneintron-myc inserted HindIII/XbaI. Intron enhances stability of mRNA.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRab1a S25N mutant
-
Alt namemember RAS oncogene family
-
Alt nameRab1a
-
SpeciesH. sapiens (human)
-
MutationS25N (dominant negative)
-
Entrez GeneRAB1A (a.k.a. RAB1, YPT1)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer BGH Reverse (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
cDNA was obtained from UMR cDNA Resource Center, www.cdna.org
To make mutation, the following primers were used for PCR amplification:
Rab1 S25N FWD (5′-AGCTCGGATCCACCATGTCCAGCATGAATCCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGACTCAGGGGTTGGAAAGAATTGCCTTCTTCT-3′)
BGH RVS primer (5′-TAGAAGGCACAGTCGAGG-3′)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PCMV-intron myc Rab1a S25N was a gift from Terry Hébert (Addgene plasmid # 46777 ; http://n2t.net/addgene:46777 ; RRID:Addgene_46777) -
For your References section:
Seven transmembrane receptor core signaling complexes are assembled prior to plasma membrane trafficking. Dupre DJ, Robitaille M, Ethier N, Villeneuve LR, Mamarbachi AM, Hebert TE. J Biol Chem. 2006 Nov 10;281(45):34561-73. Epub 2006 Sep 7. 10.1074/jbc.M605012200 PubMed 16959776
Map uploaded by the depositor.