Skip to main content

pMA3228
(Plasmid #46856)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46856 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMA3200
  • Backbone manufacturer
    Homemade
  • Backbone size w/o insert (bp) 7471
  • Total vector size (bp) 8036
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ExoY K81M
  • Species
    Pseudomonas aeruginosa
  • Promoter TRE-Tight
  • Tags / Fusion Proteins
    • Myc (C terminal on backbone)
    • FKBP E31G, R71G, K105E (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site BsrGI (destroyed during cloning)
  • 5′ sequencing primer ctatagtgaatagagttagg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMA3228 was a gift from Mikhail Alexeyev & Troy Stevens (Addgene plasmid # 46856 ; http://n2t.net/addgene:46856 ; RRID:Addgene_46856)
  • For your References section:

    Pseudomonas aeruginosa exotoxin Y is a promiscuous cyclase that increases endothelial tau phosphorylation and permeability. Ochoa CD, Alexeyev M, Pastukh V, Balczon R, Stevens T. J Biol Chem. 2012 Jul 20;287(30):25407-18. doi: 10.1074/jbc.M111.301440. Epub 2012 May 25. 10.1074/jbc.M111.301440 PubMed 22637478