pMA3228
(Plasmid
#46856)
-
PurposeA lentiviral vector encoding a fusion between codon-optimized P.aeruginosa exoY mutant (K81M) and myc-tagged destabilized FKBP12
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMA3200
-
Backbone manufacturerHomemade
- Backbone size w/o insert (bp) 7471
- Total vector size (bp) 8036
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExoY K81M
-
SpeciesPseudomonas aeruginosa
- Promoter TRE-Tight
-
Tags
/ Fusion Proteins
- Myc (C terminal on backbone)
- FKBP E31G, R71G, K105E (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site BsrGI (destroyed during cloning)
- 5′ sequencing primer ctatagtgaatagagttagg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA3228 was a gift from Mikhail Alexeyev & Troy Stevens (Addgene plasmid # 46856 ; http://n2t.net/addgene:46856 ; RRID:Addgene_46856) -
For your References section:
Pseudomonas aeruginosa exotoxin Y is a promiscuous cyclase that increases endothelial tau phosphorylation and permeability. Ochoa CD, Alexeyev M, Pastukh V, Balczon R, Stevens T. J Biol Chem. 2012 Jul 20;287(30):25407-18. doi: 10.1074/jbc.M111.301440. Epub 2012 May 25. 10.1074/jbc.M111.301440 PubMed 22637478