pMA3431
(Plasmid
#46876)
-
PurposeA lentiviral vector for the doxycycline-inducible expression of soluble guanylate cyclase1 alpha3 mutant R592Q
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46876 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMA3211
- Backbone size w/o insert (bp) 6642
- Total vector size (bp) 8700
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesoluble guanylate cyclase 1alpha 3
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2137
-
MutationR592Q
-
Entrez GeneGucy1a3 (a.k.a. Gucy1a1, SGC)
- Promoter TRE-Tight
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ctatagtgaatagagttagg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOpen Biosystems
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA3431 was a gift from Mikhail Alexeyev & Troy Stevens (Addgene plasmid # 46876 ; http://n2t.net/addgene:46876 ; RRID:Addgene_46876) -
For your References section:
Pseudomonas aeruginosa exotoxin Y is a promiscuous cyclase that increases endothelial tau phosphorylation and permeability. Ochoa CD, Alexeyev M, Pastukh V, Balczon R, Stevens T. J Biol Chem. 2012 Jul 20;287(30):25407-18. doi: 10.1074/jbc.M111.301440. Epub 2012 May 25. 10.1074/jbc.M111.301440 PubMed 22637478