Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLKO-sh-mSH3BP4
(Plasmid #46894)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46894 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SH3BP4
  • Alt name
    BOG25
  • Alt name
    SH3-domain binding protein 4
  • gRNA/shRNA sequence
    GCCCTATAGTAACAACCCTTT
  • Species
    M. musculus (mouse)
  • Mutation
    W92A (mutated SH3 domain)
  • Entrez Gene
    Sh3bp4 (a.k.a. AI594717, AW227605, BOG25)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-sh-mSH3BP4 was a gift from Do-Hyung Kim (Addgene plasmid # 46894 ; http://n2t.net/addgene:46894 ; RRID:Addgene_46894)
  • For your References section:

    SH3BP4 is a negative regulator of amino acid-Rag GTPase-mTORC1 signaling. Kim YM, Stone M, Hwang TH, Kim YG, Dunlevy JR, Griffin TJ, Kim DH. Mol Cell. 2012 Jun 29;46(6):833-46. doi: 10.1016/j.molcel.2012.04.007. Epub 2012 May 9. 10.1016/j.molcel.2012.04.007 PubMed 22575674