Skip to main content

YFP-Parkin C431N
(Plasmid #46924)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46924 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEYFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4698
  • Total vector size (bp) 6096
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Park2
  • Alt name
    Parkin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1398
  • Mutation
    changed cysteine 431 to asparagine
  • GenBank ID
    NM_004562
  • Entrez Gene
    PRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
  • Promoter CMV
  • Tag / Fusion Protein
    • EYFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer AGAAGCGCGATCACATGG
  • 3′ sequencing primer CTACAAATGTGGTATGGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    YFP-Parkin C431N was a gift from Richard Youle (Addgene plasmid # 46924 ; http://n2t.net/addgene:46924 ; RRID:Addgene_46924)
  • For your References section:

    PINK1 drives Parkin self-association and HECT-like E3 activity upstream of mitochondrial binding. Lazarou M, Narendra DP, Jin SM, Tekle E, Banerjee S, Youle RJ. J Cell Biol. 2013 Jan 21;200(2):163-72. doi: 10.1083/jcb.201210111. Epub 2013 Jan 14. 10.1083/jcb.201210111 PubMed 23319602