-
PurposePlasmid for cloning and expression of GFP-FLAG tagged proteins (N-terminal tag). Confers resistance to G418.
-
Depositing Lab
-
Depositing OrganizationGurdon Institute
Located in United Kingdom of Great Britain and Northern Ireland -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46956 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 4766
-
Modifications to backboneInserted a FLAG tag and XhoI and NotI unique restriction sites between BglII and HindIII.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFLAG tag
-
SpeciesSynthetic
-
Insert Size (bp)35
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GCAAGTAAAACCTCTACAAATGTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-FLAG was a gift from Steve Jackson (Addgene plasmid # 46956 ; http://n2t.net/addgene:46956 ; RRID:Addgene_46956) -
For your References section:
A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair. Britton S, Coates J, Jackson SP. J Cell Biol. 2013 Jul 29. 10.1083/jcb.201303073 PubMed 23897892