-
PurposePlasmid for expression of GFP-FLAG tagged human XRCC4 isoform 2 (N-terminal tag). Confers resistance to G418.
-
Depositing Lab
-
Depositing OrganizationGurdon Institute
Located in United Kingdom of Great Britain and Northern Ireland -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46959 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 46959-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 46959-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1-FLAG
- Backbone size w/o insert (bp) 4766
- Total vector size (bp) 5785
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXRCC4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1005
-
GenBank IDNM_022406.2
-
Entrez GeneXRCC4 (a.k.a. SSMED, hXRCC4)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP-2xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GCAAGTAAAACCTCTACAAATGTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 46959-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 46959-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-FLAG-XRCC4 was a gift from Steve Jackson (Addgene plasmid # 46959 ; http://n2t.net/addgene:46959 ; RRID:Addgene_46959) -
For your References section:
A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair. Britton S, Coates J, Jackson SP. J Cell Biol. 2013 Jul 29. 10.1083/jcb.201303073 PubMed 23897892