p201N 1514
(Plasmid
#47025)
-
PurposeContains soybean miRNA miR1514 recognition sequence to produce siRNAs from 3' target sequences and induce RNA silencing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepPZP
- Backbone size w/o insert (bp) 6200
- Total vector size (bp) 10626
-
Modifications to backboneInclusion of aph gene for bacterial selection on kanamycin.
-
Vector typeRNAi
-
Selectable markersG418, kanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namegma-miR1514 recognition sequence
-
SpeciesGlycine max
-
Insert Size (bp)22
- Promoter GmUbi
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (destroyed during cloning)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGAGATTGCTTCAGATCCGTA
- 3′ sequencing primer CCATTTCCATTTCACAGTTCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namenptII selectable marker
-
Alt nameneomycin phosphotransferase II
-
SpeciesEscherichia coli
-
Insert Size (bp)795
- Promoter StUbi-3
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer AGCGGATAACAATTTCACACAGGA
- 3′ sequencing primer GCAGAGCTTACACTCTCATTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The GmUbi promoter requires a license for distribution to commercial entities.
miRNA target sequence is: CAATGCCTATTTTAGAAATGAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p201N 1514 was a gift from Wayne Parrott (Addgene plasmid # 47025 ; http://n2t.net/addgene:47025 ; RRID:Addgene_47025) -
For your References section:
Simple gene silencing using the trans-acting siRNA pathway. Jacobs TB, Lawler NJ, LaFayette PR, Vodkin LO, Parrott WA. Plant Biotechnol J. 2015 Mar 27. doi: 10.1111/pbi.12362. 10.1111/pbi.12362 PubMed 25816689