Skip to main content

CS2-Myc-dLIS1
(Plasmid #47047)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47047 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CS2
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Lis1
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    Lis-1 (a.k.a. Dmel_CG8440, CG8440, D-Lis1, DLIS-1, DLIS1, DLis-1, DLis1, Dlis-1, Dlis1, DmLIS1, Dmel\CG8440, LIS-1, Lis 1, Lis1, dLis1, l(2)k13209, l(2R)W8, lis-1, lis1, n(2)k11702)
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Fse1 (not destroyed)
  • 3′ cloning site Asc1 (not destroyed)
  • 5′ sequencing primer atgaaaatggtgttgtcgcag
  • 3′ sequencing primer aaggtctgggaatgtcgttaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CS2-Myc-dLIS1 was a gift from Laura Lee (Addgene plasmid # 47047 ; http://n2t.net/addgene:47047 ; RRID:Addgene_47047)
  • For your References section:

    Human Asunder promotes dynein recruitment and centrosomal tethering to the nucleus at mitotic entry. Jodoin JN, Shboul M, Sitaram P, Zein-Sabatto H, Reversade B, Lee E, Lee LA. Mol Biol Cell. 2012 Dec;23(24):4713-24. doi: 10.1091/mbc.E12-07-0558. Epub 2012 Oct 24. 10.1091/mbc.E12-07-0558 PubMed 23097494