pZH051
(Plasmid
#47311)
-
PurposeExpresses Tsr-Venus-Ubiquitin-CI
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47311 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBR322
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 4225
- Total vector size (bp) 9600
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionscan grow at 30C, 37C or RT
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namewild type immunity region of lambda phage with tsr-venus-ub-cI
-
Insert Size (bp)5375
- Promoter PR; PRM
-
Tag
/ Fusion Protein
- CI (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctatcgactacgcgatcatgg
- 3′ sequencing primer cgatcttccccatcggtgatg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZH051 was a gift from Jie Xiao (Addgene plasmid # 47311 ; http://n2t.net/addgene:47311 ; RRID:Addgene_47311) -
For your References section:
Stochastic expression dynamics of a transcription factor revealed by single-molecule noise analysis. Hensel Z, Feng H, Han B, Hatem C, Wang J, Xiao J. Nat Struct Mol Biol. 2012 Aug;19(8):797-802. doi: 10.1038/nsmb.2336. Epub 2012 Jul 1. 10.1038/nsmb.2336 PubMed 22751020