Skip to main content

AU1-TTC30A2-pcDNA3
(Plasmid #47324)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47324 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5546
  • Total vector size (bp) 7504
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TTC30A2
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ttc30a2 (a.k.a. RP23-179N22.2, OTTMUSG00000015167)
  • Promoter CMV
  • Tag / Fusion Protein
    • AU1 epitope (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CTAGAGAACCCACTGCTTACTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGCTGATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AU1-TTC30A2-pcDNA3 was a gift from Richard Maurer (Addgene plasmid # 47324 ; http://n2t.net/addgene:47324 ; RRID:Addgene_47324)
  • For your References section:

    Interaction of mouse TTC30/DYF-1 with multiple intraflagellar transport complex B proteins and KIF17. Howard PW, Jue SF, Maurer RA. Exp Cell Res. 2013 Jun 25. pii: S0014-4827(13)00271-1. doi: 10.1016/j.yexcr.2013.06.010. 10.1016/j.yexcr.2013.06.010 PubMed 23810713