Skip to main content

pAraTMwt
(Plasmid #47514)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47514 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTrc99
  • Total vector size (bp) 5611
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Integrin alpha2B L980A TM-CYTO
  • Species
    Synthetic
  • Insert Size (bp)
    138
  • Promoter Tac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gcgctgaagtcttacgagga
  • 3′ sequencing primer TTATGACAACTTGACGGCTACATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Addgene QC sequence identifed a S23P mutation in the MBP insert that does not effect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAraTMwt was a gift from Bryan Berger (Addgene plasmid # 47514 ; http://n2t.net/addgene:47514 ; RRID:Addgene_47514)
  • For your References section:

    A Novel Assay for Assessing Juxtamembrane and Transmembrane Domain Interactions Important for Receptor Heterodimerization. Su PC, Berger BW. J Mol Biol. 2013 Jul 19. pii: S0022-2836(13)00456-7. doi: 10.1016/j.jmb.2013.07.022. 10.1016/j.jmb.2013.07.022 PubMed 23876708