nes714Δ1388-1507tk/lacZ
(Plasmid
#47616)
-
Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancer
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47616 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneSaStk/lacZ
-
Backbone manufacturerClontech; modified by Lendahl lab
-
Modifications to backboneremoved SalI site from pTKbeta and replaced HSV tk promoter with a basic HSV tk promoter containing SalI site.
-
Vector typeenhancer reporter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenestin 2nd intron fragment
-
Alt nameNES
-
SpeciesH. sapiens (human)
-
Insert Size (bp)595
-
Mutation714 bp from 3' end of 2nd intron with a deletion of nt 1388-1507
-
Entrez GeneNES (a.k.a. Nbla00170)
- Promoter HSV tk promoter
-
Tags
/ Fusion Proteins
- HSV tk promoter (C terminal on backbone)
- lacZ (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer SaStk/lacZ 5 (gtcggggctggcttaactat)
- 3′ sequencing primer LacZ-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HindIII cleavage excises the complete enhancer-tk promoter-lacZ fragment from the vector. The lacZ gene can be removed from the SaStk/lacZ vector after cleavage with NotI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nes714Δ1388-1507tk/lacZ was a gift from Urban Lendahl (Addgene plasmid # 47616 ; http://n2t.net/addgene:47616 ; RRID:Addgene_47616) -
For your References section:
Identification of both general and region-specific embryonic CNS enhancer elements in the nestin promoter. Lothian C, Prakash N, Lendahl U, Wahlstrom GM. Exp Cell Res. 1999 May 1;248(2):509-19. 10.1006/excr.1999.4417 PubMed 10222142
Map uploaded by the depositor.
