Skip to main content

nes714Δ1388-1507tk/lacZ
(Plasmid #47616)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47616 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    SaStk/lacZ
  • Backbone manufacturer
    Clontech; modified by Lendahl lab
  • Modifications to backbone
    removed SalI site from pTKbeta and replaced HSV tk promoter with a basic HSV tk promoter containing SalI site.
  • Vector type
    enhancer reporter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nestin 2nd intron fragment
  • Alt name
    NES
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    595
  • Mutation
    714 bp from 3' end of 2nd intron with a deletion of nt 1388-1507
  • Entrez Gene
    NES (a.k.a. Nbla00170)
  • Promoter HSV tk promoter
  • Tags / Fusion Proteins
    • HSV tk promoter (C terminal on backbone)
    • lacZ (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer SaStk/lacZ 5 (gtcggggctggcttaactat)
  • 3′ sequencing primer LacZ-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

HindIII cleavage excises the complete enhancer-tk promoter-lacZ fragment from the vector. The lacZ gene can be removed from the SaStk/lacZ vector after cleavage with NotI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nes714Δ1388-1507tk/lacZ was a gift from Urban Lendahl (Addgene plasmid # 47616 ; http://n2t.net/addgene:47616 ; RRID:Addgene_47616)
  • For your References section:

    Identification of both general and region-specific embryonic CNS enhancer elements in the nestin promoter. Lothian C, Prakash N, Lendahl U, Wahlstrom GM. Exp Cell Res. 1999 May 1;248(2):509-19. 10.1006/excr.1999.4417 PubMed 10222142