Skip to main content

pFAB806
(Plasmid #47849)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47849 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFAB766
  • Backbone size w/o insert (bp) 3967
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lambda tR2 terminator
  • Species
    Synthetic
  • Promoter pLTetO4

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer Neo-R
  • 3′ sequencing primer p15A-R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Terminator efficiency measured at 91%.

Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFAB806 was a gift from Drew Endy (Addgene plasmid # 47849 ; http://n2t.net/addgene:47849 ; RRID:Addgene_47849)
  • For your References section:

    Precise and reliable gene expression via standard transcription and translation initiation elements. Mutalik VK, Guimaraes JC, Cambray G, Lam C, Christoffersen MJ, Mai QA, Tran AB, Paull M, Keasling JD, Arkin AP, Endy D. Nat Methods. 2013 Apr;10(4):354-60. doi: 10.1038/nmeth.2404. Epub 2013 Mar 10. 10.1038/nmeth.2404 PubMed 23474465