-
PurposeGenetically encoded voltage indicator
-
Depositing Lab
-
Depositing OrganizationRIKEN Center for Brain Science
Located in Japan -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 47978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 47978-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 47978-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG
-
Backbone manufacturercustom
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVSFP Butterfly 1.2
-
SpeciesSynthetic
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site AflII (unknown if destroyed)
- 5′ sequencing primer atgaggagccgctttgtgaagaaagatggtcattgcaatgttcagtttatcaacgtgatggtgtctaaggg
- 3′ sequencing primer gaccgccgccgggatcactctcggcatggacgagctgtacaagtaag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 47978-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 47978-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-VSFP Butterfly 1.2 was a gift from Thomas Knopfel (Addgene plasmid # 47978 ; http://n2t.net/addgene:47978 ; RRID:Addgene_47978) -
For your References section:
Imaging neural circuit dynamics with a voltage-sensitive fluorescent protein. Akemann W, Mutoh H, Perron A, Park YK, Iwamoto Y, Knopfel T. J Neurophysiol. 2012 Oct;108(8):2323-37. doi: 10.1152/jn.00452.2012. Epub 2012 Jul 18. 10.1152/jn.00452.2012 PubMed 22815406