This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #59800)


Item Catalog # Description Quantity Price (USD)
Plasmid 59800 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4796
  • Total vector size (bp) 6794
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Cyan-Yellow Chimeric Butterfly Voltage Sensitive Fluorescent Protein
  • Alt name
  • Species
  • Insert Size (bp)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site AflII (unknown if destroyed)
  • 5′ sequencing primer ttcggcttctggcgtgtgacc
  • 3′ sequencing primer tagccagaagtcagatgctcaagG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Chimeric_Butterfly_CY_1.0 was a gift from Thomas Knopfel (Addgene plasmid # 59800 ; ; RRID:Addgene_59800)
  • For your References section:

    Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain. Mishina Y, Mutoh H, Song C, Knopfel T. Front Mol Neurosci. 2014 Sep 29;7:78. doi: 10.3389/fnmol.2014.00078. eCollection 2014. 10.3389/fnmol.2014.00078 PubMed 25324718