This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCAG-VSFP Butterfly 1.2
(Plasmid #47978)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 47978 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VSFP Butterfly 1.2
  • Species
    Synthetic
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site AflII (unknown if destroyed)
  • 5′ sequencing primer atgaggagccgctttgtgaagaaagatggtcattgcaatgttcagtttatcaacgtgatggtgtctaaggg
  • 3′ sequencing primer gaccgccgccgggatcactctcggcatggacgagctgtacaagtaag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-VSFP Butterfly 1.2 was a gift from Thomas Knopfel (Addgene plasmid # 47978 ; http://n2t.net/addgene:47978 ; RRID:Addgene_47978)
  • For your References section:

    Imaging neural circuit dynamics with a voltage-sensitive fluorescent protein. Akemann W, Mutoh H, Perron A, Park YK, Iwamoto Y, Knopfel T. J Neurophysiol. 2012 Oct;108(8):2323-37. doi: 10.1152/jn.00452.2012. Epub 2012 Jul 18. 10.1152/jn.00452.2012 PubMed 22815406