-
Purpose(Empty Backbone) Gateway Destination vector derived from Clontech's pmax (CAGGS) expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48222 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmaxCloning
-
Backbone manufacturerClontech
- Backbone size (bp) 2786
-
Vector typeMammalian Expression, CRISPR ; Gateway Destination
- Promoter CAGGS
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer gggcttgtcgagacagagaagat
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information including protocols and
updates, please go to http://www.crispr-on.org
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC90-pmax-DEST was a gift from Rudolf Jaenisch (Addgene plasmid # 48222 ; http://n2t.net/addgene:48222 ; RRID:Addgene_48222) -
For your References section:
Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. 10.1038/cr.2013.122 PubMed 23979020