Skip to main content

pAC94-pmax-dCas9VP160-2A-puro
(Plasmid #48226)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48226 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 48226-D50 50 μg of DNA in Tris buffer $495
DNA 48226-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pmax-DEST (Addgene: 48222)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-puro
  • Alt name
    dCas9VP160-2A-puro
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    5528
  • Mutation
    D10A;H840A (catalytically inactive)
  • Promoter CAGGS
  • Tags / Fusion Proteins
    • HA Tag (N terminal on insert)
    • VP160 (C terminal on insert)
    • 2A-puro (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer gggcttgtcgagacagagaagat
  • 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information including protocols and
updates, please go to http://www.crispr-on.org

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC94-pmax-dCas9VP160-2A-puro was a gift from Rudolf Jaenisch (Addgene plasmid # 48226 ; http://n2t.net/addgene:48226 ; RRID:Addgene_48226)
  • For your References section:

    Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. Cheng AW, Wang H, Yang H, Shi L, Katz Y, Theunissen TW, Rangarajan S, Shivalila CS, Dadon DB, Jaenisch R. Cell Res. 2013 Aug 27. doi: 10.1038/cr.2013.122. 10.1038/cr.2013.122 PubMed 23979020