Skip to main content

pBAD His6 TEV LIC transfer vector (8BT)
(Plasmid #48279)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48279 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBAD
  • Backbone size (bp) 5742
  • Vector type
    Bacterial Expression
  • Tag / Fusion Protein
    • His6 (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted via LIC cloning.

8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.8BT adds a TEV-cleavable His6 tag to the N-terminus of your protein.

To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

This vector is a transfer vector that can be used in conjunction with the 8D destination vector to create a polycistronic construct. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD His6 TEV LIC transfer vector (8BT) was a gift from Scott Gradia (Addgene plasmid # 48279)