Skip to main content

pDS69
(Plasmid #48367)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48367 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEM-T Easy
  • Backbone manufacturer
    Promega
  • Total vector size (bp) 4500
  • Vector type
    Cre/Lox ; Knockout in T. Brucei
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FLAG-intergenic region of TUB-HYG (modified from PMID 16269191)
  • Species
    T. brucei

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tb#44 CTGGTTAGTATGGACTTCTCTAGA
  • 3′ sequencing primer pBRrevBam
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html

There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab. These mismatches should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDS69 was a gift from George Cross (Addgene plasmid # 48367 ; http://n2t.net/addgene:48367 ; RRID:Addgene_48367)
  • For your References section:

    Strategies to construct null and conditional null Trypanosoma brucei mutants using Cre-recombinase and loxP. Kim HS, Li Z, Boothroyd C, Cross GA. Mol Biochem Parasitol. 2013 Aug 13;191(1):16-19. doi: 10.1016/j.molbiopara.2013.08.001. 10.1016/j.molbiopara.2013.08.001 PubMed 23954366