pFUSB4_CCTG
(Plasmid
#48462)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUS_B4
-
Vector typeMammalian Expression, TALEN
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRVD sequence: HD HD NG NN
-
SpeciesSynthetic
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttgatgcctggcagttccct
- 3′ sequencing primer cgaaccgaacaggcttatgt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid was created using Golden Gate cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUSB4_CCTG was a gift from Stephen Ekker (Addgene plasmid # 48462 ; http://n2t.net/addgene:48462 ; RRID:Addgene_48462) -
For your References section:
High Efficiency In Vivo Genome Engineering with a Simplified 15-RVD GoldyTALEN Design. Ma AC, Lee HB, Clark KJ, Ekker SC. PLoS One. 2013 May 29;8(5):e65259. doi: 10.1371/journal.pone.0065259. Print 2013. 10.1371/journal.pone.0065259 PubMed 23734242