Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pIRES-HA-14-3-3 ϵ/myc-14-3-3ζ
(Plasmid #48795)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 48795 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIRES
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6100
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH10B or similar
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    YWHAE
  • Alt name
    14-3-3ϵ
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    789
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGAATTCATGGATGATCGAGAGGATCTGGTG
  • 3′ sequencing primer AGAATTCTCAAGCATAATCTGGAACATCATATGGATACTGATTTTCGTCTTCCACGTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    YWHAZ
  • Alt name
    14-3-3 zeta
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    738
  • GenBank ID
    NM_001135699.1
  • Promoter CMV (IRES)
  • Tag / Fusion Protein
    • myc (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GCTCTAGAATGGATAAAAATGAGCTGGTTCAG
  • 3′ sequencing primer GCTCTAGATTACAGATCCTCTTCTGAGATGAGTTTTTGTTCATTTTCCCCTCCTTCTCC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIRES-HA-14-3-3 ϵ/myc-14-3-3ζ was a gift from Huda Zoghbi (Addgene plasmid # 48795 ; http://n2t.net/addgene:48795 ; RRID:Addgene_48795)
  • For your References section:

    Interaction of Akt-phosphorylated ataxin-1 with 14-3-3 mediates neurodegeneration in spinocerebellar ataxia type 1. Chen HK, Fernandez-Funez P, Acevedo SF, Lam YC, Kaytor MD, Fernandez MH, Aitken A, Skoulakis EM, Orr HT, Botas J, Zoghbi HY. Cell. 2003 May 16;113(4):457-68. 10.1016/S0092-8674(03)00349-0 PubMed 12757707