3xFNLDD/pMXs-I2
(Plasmid
#48880)
-
PurposeExpresses 3xFNLDD in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48880 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMXs-I2
-
Backbone manufacturerHodaka Fujii
- Backbone size w/o insert (bp) 6360
- Total vector size (bp) 7107
-
Vector typeMammalian Expression, Retroviral
-
Selectable markershuman CD2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFNLDD
-
Alt name3xFLAG-NLS-LexA binding domain
-
SpeciesSynthetic
-
Insert Size (bp)747
- Promoter LTR
-
Tags
/ Fusion Proteins
- 3xFLAG tag (N terminal on insert)
- NLS (nuclear localization signal) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR I (destroyed during cloning)
- 3′ cloning site Not I (destroyed during cloning)
- 5′ sequencing primer ggtggaccatcctctagact
- 3′ sequencing primer AAACGCACACCGGCCTTATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is described in the following article:
Efficient isolation of specific genomic regions by insertional chromatin immunoprecipitation (iChIP) with a second-generation tagged LexA DNA-binding domain.
Toshitsugu Fujita, Hodaka Fujii
Advances in Bioscience and Biotechnology, 2013
http://dx.doi.org/10.4236/abb.2012.35081
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xFNLDD/pMXs-I2 was a gift from Hodaka Fujii (Addgene plasmid # 48880 ; http://n2t.net/addgene:48880 ; RRID:Addgene_48880) -
For your References section:
A Critical Role of the Thy28-MYH9 Axis in B Cell-Specific Expression of the Pax5 Gene in Chicken B Cells. Fujita T, Kitaura F, Fujii H. PLoS One. 2015 Jan 21;10(1):e0116579. doi: 10.1371/journal.pone.0116579. eCollection 2015. PONE-D-14-45451 [pii] PubMed 25607658