Skip to main content
Addgene
Open Menu

mCh-Sec61 beta
(Plasmid #49155)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49155 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 49155-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 49155-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pAcGFP1-C1
  • Backbone manufacturer
    Clontech
  • Modifications to backbone
    monomeric mCherry was inserted into NheI/BglII sites of pAcGFP1-C1.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Sec61 beta
  • Alt name
    SEC61B
  • Species
    H. sapiens (human)
  • Entrez Gene
    SEC61B
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry* (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*Note that the AcGFP1 is still present in this plasmid, but it is not expressed.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCh-Sec61 beta was a gift from Gia Voeltz (Addgene plasmid # 49155 ; http://n2t.net/addgene:49155 ; RRID:Addgene_49155)

  • For your References section:

    Reticulon short hairpin transmembrane domains are used to shape ER tubules. Zurek N, Sparks L, Voeltz G. Traffic. 2011 Jan;12(1):28-41. doi: 10.1111/j.1600-0854.2010.01134.x. Epub 2010 Nov 12. 10.1111/j.1600-0854.2010.01134.x PubMed 20955502
Related items:
Commonly requested with: