-
PurposePlant transformation binary vector for Dexamethasone inducible expression of the type III effector gene avrPto
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTA7002
-
Backbone manufacturerNam-Hai Chua
-
Vector typePlant transformation binary vector
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Growth instructionsPlease note: a binary vector-compatible Agrobacterium strain (such as GV3850) will have to be used prior to plant transformation. Plasmid should be grown at 30C after transformation to Agrobacterium (37C is ok for E. coli).
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameavrPto
-
Alt nameavrPto1
-
Alt nameavrPto1DC3000
-
SpeciesPseudomonas syringae pv. tomato DC3000
-
Insert Size (bp)495
-
GenBank IDNC_004578.1
- Promoter dexamethasone inducible
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SpeI (unknown if destroyed)
- 5′ sequencing primer CCGCTCGAGACCATGGGAAATATATGTGTC
- 3′ sequencing primer GACTAGTTCATTGCCAGTTACGGTACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
An efficient Agrobacterium-mediated transient transformation of Arabidopsis.
K. Tsuda et al. Plant J. 2012 Feb;69(4):713-9
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTA7002-avrPto was a gift from Sheng Yang He (Addgene plasmid # 49156 ; http://n2t.net/addgene:49156 ; RRID:Addgene_49156) -
For your References section:
A Pseudomonas syringae type III effector suppresses cell wall-based extracellular defense in susceptible Arabidopsis plants. Hauck P, Thilmony R, He SY. Proc Natl Acad Sci U S A. 2003 Jul 8;100(14):8577-82. Epub 2003 Jun 19. 10.1073/pnas.1431173100 PubMed 12817082