Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-N1-FNIP1
(Plasmid #49175)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49175 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 8351
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Folliculin Interacting Protein 1
  • Alt name
    FNIP1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3495
  • Mutation
    Stop codon deleted
  • GenBank ID
    BC001956.1
  • Entrez Gene
    Fnip1 (a.k.a. A730024A03Rik)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-FNIP1 was a gift from Shawn Ferguson (Addgene plasmid # 49175 ; http://n2t.net/addgene:49175 ; RRID:Addgene_49175)
  • For your References section:

    Recruitment of folliculin to lysosomes supports the amino acid-dependent activation of Rag GTPases. Petit CS, Roczniak-Ferguson A, Ferguson SM. J Cell Biol. 2013 Sep 30;202(7):1107-1122. 10.1083/jcb.201307084 PubMed 24081491