Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

MR015-PRKAG2 Left TALEN
(Plasmid #49453)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49453 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MR015
  • Backbone manufacturer
    Matthew Porteus
  • Backbone size w/o insert (bp) 7053
  • Total vector size (bp) 8243
  • Vector type
    Mammalian Expression, TALEN
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALEN
  • Species
    TALEN
  • Insert Size (bp)
    1190

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GTAACAGCGGTAGAGGCAGTG
  • 3′ sequencing primer CGTCCACCAAGACATGCCAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MR015-PRKAG2 Left TALEN was a gift from Bruce Conklin (Addgene plasmid # 49453 ; http://n2t.net/addgene:49453 ; RRID:Addgene_49453)
  • For your References section:

    Isolation of single-base genome-edited human iPS cells without antibiotic selection. Miyaoka Y, Chan AH, Judge LM, Yoo J, Huang M, Nguyen TD, Lizarraga PP, So PL, Conklin BR. Nat Methods. 2014 Mar;11(3):291-3. doi: 10.1038/nmeth.2840. Epub 2014 Feb 9. 10.1038/nmeth.2840 PubMed 24509632