MR015-BAG3 Right TALEN
(Plasmid
#49466)
-
PurposeRight TALEN for BAG3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49466 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMR015
-
Backbone manufacturerMatthew Porteus
- Backbone size w/o insert (bp) 7053
- Total vector size (bp) 8243
-
Vector typeMammalian Expression, TALEN
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTALEN
-
SpeciesTALEN
-
Insert Size (bp)1190
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GTAACAGCGGTAGAGGCAGTG
- 3′ sequencing primer CGTCCACCAAGACATGCCAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MR015-BAG3 Right TALEN was a gift from Bruce Conklin (Addgene plasmid # 49466 ; http://n2t.net/addgene:49466 ; RRID:Addgene_49466) -
For your References section:
Isolation of single-base genome-edited human iPS cells without antibiotic selection. Miyaoka Y, Chan AH, Judge LM, Yoo J, Huang M, Nguyen TD, Lizarraga PP, So PL, Conklin BR. Nat Methods. 2014 Mar;11(3):291-3. doi: 10.1038/nmeth.2840. Epub 2014 Feb 9. 10.1038/nmeth.2840 PubMed 24509632