EGFP-Rab6B
(Plasmid
#49470)
-
Purposeexpresses EGFP-Rab6B in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49470 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEGFP C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5300
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab6B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)627
-
GenBank IDAF498940
-
Entrez GeneRAB6B
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI/BglII (destroyed during cloning)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypurchased pCDNA3.1+Rab6B from Missouri S&T cDNA Resource Center (cDNA.org)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Rab6B was a gift from Marci Scidmore (Addgene plasmid # 49470) -
For your References section:
Rab GTPases are recruited to chlamydial inclusions in both a species-dependent and species-independent manner. Rzomp KA, Scholtes LD, Briggs BJ, Whittaker GR, Scidmore MA. Infect Immun. 2003 Oct;71(10):5855-70. 10.1128/IAI.71.10.5855-5870.2003 PubMed 14500507