Skip to main content

EGFP-Rab10
(Plasmid #49472)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49472 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EGFP C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5300
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab10
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    627
  • GenBank ID
    AF498945
  • Entrez Gene
    RAB10
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BHI/BglII (destroyed during cloning)
  • 3′ cloning site XhoI/SalI (destroyed during cloning)
  • 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    purchased pCDNA3.1+Rab10 from Missouri S&T cDNA Resource Center (cDNA.org)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

BamHI/XhoI fragment encoding Rab10 cloned into BglII/SalI site of EGFP C1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Rab10 was a gift from Marci Scidmore (Addgene plasmid # 49472)
  • For your References section:

    Rab GTPases are recruited to chlamydial inclusions in both a species-dependent and species-independent manner. Rzomp KA, Scholtes LD, Briggs BJ, Whittaker GR, Scidmore MA. Infect Immun. 2003 Oct;71(10):5855-70. 10.1128/IAI.71.10.5855-5870.2003 PubMed 14500507