-
Purposeexpresses EGFP-Rab10 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationCornell University
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49472 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneEGFP C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5300
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)627
-
GenBank IDAF498945
-
Entrez GeneRAB10
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BHI/BglII (destroyed during cloning)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypurchased pCDNA3.1+Rab10 from Missouri S&T cDNA Resource Center (cDNA.org)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
BamHI/XhoI fragment encoding Rab10 cloned into BglII/SalI site of EGFP C1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Rab10 was a gift from Marci Scidmore (Addgene plasmid # 49472) -
For your References section:
Rab GTPases are recruited to chlamydial inclusions in both a species-dependent and species-independent manner. Rzomp KA, Scholtes LD, Briggs BJ, Whittaker GR, Scidmore MA. Infect Immun. 2003 Oct;71(10):5855-70. 10.1128/IAI.71.10.5855-5870.2003 PubMed 14500507