Skip to main content

EGFP-Rab4AS22N
(Plasmid #49476)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49476 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EGFP C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 5300
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab4AS22N
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    650
  • Mutation
    Serine 22 to Asparagine**
  • GenBank ID
    AF498934
  • Entrez Gene
    RAB4A (a.k.a. HRES-1, HRES-1/RAB4, HRES1, RAB4)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI/BglII (destroyed during cloning)
  • 3′ cloning site XhoI/SalI (destroyed during cloning)
  • 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    purchased from Missouri S&T cDNA Resource Center (cDNA.org) pCDNA3.1+Rab4A
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

** Note, this mutation corresponds to S27A in the full length Rab4A

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Rab4AS22N was a gift from Marci Scidmore (Addgene plasmid # 49476)
  • For your References section:

    The GTPase Rab4 interacts with Chlamydia trachomatis inclusion membrane protein CT229. Rzomp KA, Moorhead AR, Scidmore MA. Infect Immun. 2006 Sep;74(9):5362-73. 10.1128/IAI.00539-06 PubMed 16926431