Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

EGFP-Rab10T23N
(Plasmid #49545)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49545 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    EGFP C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5300
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab10T23N
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    600
  • Mutation
    Threonine 23 to Asparagine
  • GenBank ID
    AF498945
  • Entrez Gene
    RAB10
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI/BglII (destroyed during cloning)
  • 3′ cloning site XhoI/SalI (destroyed during cloning)
  • 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rab10 cDNA derived from pCDNA3.1-Rab10 purchased from Missouri S&T cDNA Resource Center
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Rab10T23N was a gift from Marci Scidmore (Addgene plasmid # 49545)
  • For your References section:

    The Anaplasma phagocytophilum-occupied vacuole selectively recruits Rab-GTPases that are predominantly associated with recycling endosomes. Huang B, Hubber A, McDonough JA, Roy CR, Scidmore MA, Carlyon JA. Cell Microbiol. 2010 Sep 1;12(9):1292-307. doi: 10.1111/j.1462-5822.2010.01468.x. Epub 2010 Mar 25. 10.1111/j.1462-5822.2010.01468.x PubMed 20345488