EGFP-CERT-PH
(Plasmid
#49572)
-
Purposeexpresses the plekstrin homology domain of CERT/OSBP in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49572 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEGFP C2
-
Backbone manufacturerc
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPBP
-
Alt nameCERT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)378
-
Mutationexpresses AA 1-122
-
GenBank IDNM_031361.2
-
Entrez GeneCERT1 (a.k.a. CERT, CERTL, COL4A3BP, GPBP, MRD34, STARD11)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
PH binding domain of GPBP recognizes PI4P
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-CERT-PH was a gift from Marci Scidmore (Addgene plasmid # 49572 ; http://n2t.net/addgene:49572 ; RRID:Addgene_49572) -
For your References section:
Multiple host proteins that function in phosphatidylinositol-4-phosphate metabolism are recruited to the chlamydial inclusion. Moorhead AM, Jung JY, Smirnov A, Kaufer S, Scidmore MA. Infect Immun. 2010 May;78(5):1990-2007. doi: 10.1128/IAI.01340-09. Epub 2010 Mar 15. 10.1128/IAI.01340-09 PubMed 20231409
Map uploaded by the depositor.